|
Click
here for the latest USGENE reference materials
Summary of USGENE
USGENE is the unparalleled resource to perform freedom-to-operate,
prior art, validity and infringement patent sequence searches
in US gene patent
publications. It is also ideal for anyone who needs the most
up-to-date sequence data from the United States Patent and
Trademark Office (USPTO).
USGENE covers all available peptide and nucleic acid sequences
from the published applications and issued patents of the
USPTO dating back to 1982. Each database record contains a
sequence and related data including organism name, sequence
length and feature tables for modifications and other features.
Extensive bibliographic and text search options, including
publication title, abstract, patent assignees at issue, full
inventor names plus the complete set of publication, application
and parent case WIPO/PCT numbers and dates are also provided.
Data are typically available within 3
days of publication by the USPTO.
A summary of USGENE
content and coverage is available.
USGENE offers three advanced sequence searching methods:
NCBI BLAST®, FastA-based GETSIM and GETSEQ for fragment
or motif sequence queries.
USGENE is produced by the SequenceBase
Corporation, and is provided on STN by FIZ Karlsruhe as
File USGENE.
A typical USGENE® database record in IALL
ALIGN display format
L1 ANSWER 1 OF 1 USGENE COPYRIGHT 2008 SEQUENCEBASE CORP on STN
ACCESSION NUMBER: 7304209.1 DNA  USGENE
TITLE:  Herbicide-tolerant plants through bypassing metabolic
pathway (Patent)
INVENTOR(S): Zink Olivier (Clermont-Ferrand, FR); Paget Eric (Caluire,
FR); Rolland Anne (Lyons, FR); Sailland Alain
(Saint-Didier-Au-Mont-d'or, FR); Freyssinet Georges
(Saint-Cyr-Au-Mont-d'or, FR)
PATENT ASSIGNEE: Bayer CropScience SA (FR)
PATENT INFORMATION: US 7304209 B2 20071204
 US 20040073966 A1 20040415
WO 2002036787 A 20020510
APPLICATION INFO: US 2001-415302 20011030
REL APPL INFO: WO 2001-FR3364 20011030
ENTRY DATE: 20071206
DOCUMENT TYPE: Patent
ABSTRACT: DNA sequence of a gene of hydroxy-phenyl pyruvate
dioxygenase and production of plants containing a gene of
 hydroxy-phenyl pyruvate dioxygenase and which are resistant
to herbicides. DNA sequence of a gene of hydroxy-phenyl
pyruvate dioxygenase; isolation from a bacteria or a plant;
utilization for obtaining plants tolerant to herbicides.
|
USGENE Accession
Number (AN), including the
sequence identity number
(SEQ ID NO)
Molecule Type
(MTY)
Original patent
title
Bibliographic
information –
Publication, application,
assignee & inventor data
Original patent
abstract
|
-
CLAIM:
-
US7304209 B2: 1. An isolated nucleic acid encoding an HPP
oxidase, characterized in that it comprises a nucleic acid
sequence selected from the group comprising the coding
sequences of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and
SEQ ID No. 15, or a nucleic acid capable of selectively
hybridizing to the coding sequence of said SEQ ID No. 1, 3,
5 or 15 under the following conditions: prehybridization
for four hours at 68? C. in a solution of 5?SSC, 6%
Denhardt's, and 0.5% SDS; hybridization for sixteen hours
at 68? C.; and washes at 65? C. in 0.5?SSC, 0.1% SDS.
2. An expression cassette comprising a coding sequence,
characterized in that the coding sequence comprises the
nucleic acid as claimed in claim 1.
3. A cloning or expression vector, characterized in that it
comprises the expression cassette as claimed in claim 2.
4. A transformed plant cell, characterized in that it
comprises the expression cassette as claimed in claim 2.
5. A transformed plant, characterized in that it comprises
the expression cassette as claimed in claim 2.
6. A seed of a transformed plant as claimed in claim 5,
characterized in that it comprises at least one the
expression cassette comprising a coding sequence,
characterized in that the coding sequence comprises a
nucleic acid sequence which encodes a polypeptide that has
HPP oxidase activity.
7. A method of transforming plants, characterized in that
the expression cassette as claimed in claim 2 is introduced
into their genome.
8. A method for selective weeding of plants comprising the
step of applying an HPPD inhibitor to a transformed plant
as claimed in claim 5.
9. A method of weed killing in an area of a field
comprising the seed as claimed in claim 6, characterized in
that it comprises the application, in said area of the
field, of a dose, which is toxic for said weeds, of an
HPPD-inhibiting herbicide, without however substantially
affecting the seed.
10. A method of growing a transformed plant as claimed in
claim 5, characterized in that it comprises sowing a seed
of said transformed plant in an area of a field suitable
for growing said plant, applying to said area of said field
a dose, which is toxic for the weeds, of a herbicide having
HPPD as the target, in the event of weeds being present,
without substantially affecting said seed or said
transformed plant, then harvesting the plants grown when
they reach the desired maturity and, optionally, separating
the seeds from the harvested plants.
11. The method as claimed in claim 8, characterized in that
the herbicide is applied in pre-emergence and/or in
post-emergence.
12. A method of weed killing in an area of a field
comprising a transformed plant as claimed in claim 5,
characterized in that it comprises the application, in said
area of the field, of a dose, which is toxic for said
weeds, of an HPPD-inhibiting herbicide, without however
substantially affecting the transformed plant.
13. The method as claimed in claim 9, characterized in that
the herbicide is applied in pre-emergence and/or in
post-emergence.
14. The method as claimed in claim 10, characterized in
that the herbicide is applied in pre-emergence and/or in
post-emergence.
15. A method of growing plants tolerant to a herbicide
which is an HPPD inhibitor, comprising the step of growing
plants expressing at least one enzyme insensitive to said
herbicide that allows conversion of para-
hydroxyphenylpyruvate (HPP) to 4-hydroxyphenyl-acetic acid
(4-HPA) and at least one enzyme insensitive to said
herbicide that allows conversion of 4-HPA to homogentisate
as a result of nucleic acid encoding said enzymes being
inserted into the genome of said plants, wherein said at
least one enzyme that allows conversion of
para-hydroxyphenylpyruvate (HPP) to 4-hydroxyphenyl-acetic
acid (4-HPA) is HPP oxidase, wherein said HPP oxidase
comprises an amino acid sequence selected from the group
consisting of SEQ ID NOS: 2, 4, 6 and 16.
16. The method as claimed in claim 15, characterized in
that an HPAH and an HPAC are expressed in the plant.
17. The method of claim 15 wherein said HPP oxidase is
encoded by the coding sequence of a nucleic acid selected
from the group consisting of SEQ ID NOS: 1, 3, 5 and 15.
18. A method of growing plants tolerant to a herbicide
which is an HPPD inhibitor, comprising the step of growing
plants expressing at least one enzyme insensitive to said
herbicide that allows conversion of para-
hydroxyphenylpyruvate (HPP) to 4-hydroxyphenyl-acetic acid
(4-HPA) as a result of nucleic acid encoding said enzyme
being inserted into the genome of said plants, wherein said
at least one enzyme that allows conversion of
para-hydroxyphenylpyruvate (HPP) to 4-hydroxyphenyl-acetic
acid (4-HPA) is HPP oxidase, wherein said HPP oxidase
comprises an amino acid sequence selected from the group
consisting of SEQ ID NOS: 2, 4, 6 and 16.
19. The method of claim 18 wherein said HPP oxidase is
encoded by the coding sequence of a nucleic acid selected
from the group consisting of SEQ ID NOS: 1, 3, 5 and 15.
20. A method for making plants tolerant to a herbicide
which is an HPPD inhibitor, comprising the steps
ofinserting a nucleic acid encoding at least one enzyme
insensitive to said herbicide that allows conversion of
para-hydroxyphenylpyruvate (HPP) to 4-hydroxyphenyl-acetic
acid (4-HPA) and a nucleic acid encoding at least one
enzyme insensitive to said herbicide that allows conversion
of 4-HPA to homogentisate, wherein said at least one enzyme
that allows conversion of para-hydroxyphenylpyruvate (HPP)
to 4-hydroxyphenyl-acetic acid (4-HPA) is HPP oxidase, and
wherein said HPP oxidase comprises an amino acid sequence
selected from the group consisting of SEQ ID NOS: 2, 4, 6
and 16, into the genome of a plant cell;regenerating a
plant from said plant cell; andgrowing said plant, wherein
said at least one enzyme insensitive to said herbicide that
allows conversion of para-hydroxyphenylpyruvate (HPP) to
4-hydroxyphenyl-acetic acid (4-HPA) and said at least one
enzyme insensitive to said herbicide that allows conversion
of 4-HPA to homogentisate are expressed in said plant.
21. A method for making plants tolerant to a herbicide
which is an HPPD inhibitor, comprising the steps
ofinserting a nucleic acid encoding at least one enzyme
insensitive to said herbicide that allows conversion of
para-hydroxyphenylpyruvate (HPP) to 4-hydroxyphenyl-acetic
acid (4-HPA), wherein said at least one enzyme that allows
conversion of para-hydroxyphenylpyruvate (HPP) to
4-hydroxyphenyl-acetic acid (4-HPA) is HPP oxidase, and
wherein said HPP oxidase comprises an amino acid sequence
selected from the group consisting of SEQ ID NOS: 2, 4, 6
and 16, into the genome of a plant cell;regenerating a
plant from said plant cell; andgrowing said plant, wherein
said at least one enzyme insensitive to said herbicide that
allows conversion of para-hydroxyphenylpyruvate (HPP) to
4-hydroxyphenyl-acetic acid (4-HPA) is expressed in said
plant
|
Full
patent claims (click on "CLAIM" to expand or
collapse the text). |
SEQUENCE SOURCE: NUCLEIC; USPTO; GRANTED
ORGANISM NAME: Arthrobacter globiformis
SEQUENCE LENGTH: 1683
SEQUENCE:
1 atgacttcac ttacagtgtc cggccgggtg gcgcaggtcc tcagcagcta
51 tgtcagcgat gtgttcggtg tgatgggcaa cggaaacgtc tacttcctgg
101 acgccgccga gaaggagggc ctccgcttca cggccgtacg ccatgaaggt
151 gccgccatcg cggcggcgga cgcctactat cgggcatccg ggcgcctggc
201 ggcggggacc accacctacg gccccggtta caccaacgcc ctgacggccc
251 tcgccgaggc ggtccaggcg cagatccccg tggtgctcgt caccggggac
301 gccccgagca gcggcgcccg gccttgggac gtggaccagg ccgcgatcgc
351 cgccgggctg ggggcggcga ccttcacggt cacccgtgaa gccgcaggct
401 ccatcacgca ggaagcggtg gagtacgcac ttgcccggcg gaccgccgtc
451 gtgatcgccg ttccatacga cctgtcggcc cttgaggcgg cggaggaaga
501 tcttcccgtg ccgccggcgg cctcggttcc ggacgccatc ggcggcggac
551 tcggacgggc ggccgaagtg cgggcggccg aattgctggc gggcgcgaag
601 cggccgctca tccttgccgg ccgcggtgcg cacctcgcag gagccggccc
651 cgaactccgg gaactcgccg accgcctcgg cgcgctcacg gccggcaccg
701 cactggcgct gaacctgctg cagggcgagg ggtacctcgg cgtcgcgggc
751 ggcttcggca cggataccgc cgccgggctc atgggcgagg cggacgtggt
801 gctcgtggcg ggagccagcc tgaccccctt caccatgcgc ttcggccacc
851 tgatcggccc ggacgccacc gtgatccaga tcgacaccgc catggagccg
901 acggacccgc gggtggacct gtttgtcagt gcggacgcga aggccgctgc
951 cggccggatc ctccggctgc tggatgacgc cgccggggcc aatgcgtcga
1001 aggcctggcg cgcggaagca ctcaagcgtc tggccgaagg accctgccac
1051 caccccggca ccgcagagac cacggacggc cgccttgacc cccgggcgct
1101 tgcttcggca ctggatgccg tcctgccgga acgccgcacc gtggtccagg
1151 acggcgggca cttcctgggc tgggcaccca tgtactggcg catcccccgt
1201 cctcaggacc tggtcatggt ggggaccgcg taccagtcga tcgggcttgg
1251 cctggccagc gccgtggggg cgtcccgggc cgtggacgac ggcaatatcc
1301 tggtgctggc ggcgggcgac ggcggattcc tgatgggcct gtccgacctg
1351 gaatcgctcg tgggcgcggc gagcagcgcc gtcgtggtga tctacaacga
1401 cgccgcctac ggggccgaga tccatcagta cggctcacgg gggctcaccg
1451 aaaagcccat gctgatcccc gaagtggact tcagcgggat tgcccgcgcg
1501 atcggggcgg aatccgcaat catccgcaag ctgtcggacc tctccgcgct
1551 cacggactgg atcgaggccg gcgccagggg aaccttcgtg gccgactgcc
1601 gcatcacctc aagcgtccgg gccccgtggc tgagcgaatg gatgagggcc
1651 tcgcaagcgg cgaaggaggc ggtggcgggc tag
FEATURE TABLE:
Key |Location |
==========+===========+=======================
CDS |(1)..(1683)|
BLASTALIGN 
Query = 540 letters
Length = 1683
Score = 1070 bits (540), Expect = 0.0
Identities = 540/540 (100%)
Strand = Plus / Plus
Query: 1 acgccgccgagaaggagggcctccgcttcacggccgtacgccatgaaggtgccgccatcg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 101 acgccgccgagaaggagggcctccgcttcacggccgtacgccatgaaggtgccgccatcg
Query: 61 cggcggcggacgcctactatcgggcatccgggcgcctggcggcggggaccaccacctacg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 161 cggcggcggacgcctactatcgggcatccgggcgcctggcggcggggaccaccacctacg
Query: 121 gccccggttacaccaacgccctgacggccctcgccgaggcggtccaggcgcagatccccg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 221 gccccggttacaccaacgccctgacggccctcgccgaggcggtccaggcgcagatccccg
Query: 181 tggtgctcgtcaccggggacgccccgagcagcggcgcccggccttgggacgtggaccagg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 281 tggtgctcgtcaccggggacgccccgagcagcggcgcccggccttgggacgtggaccagg
Query: 241 ccgcgatcgccgccgggctgggggcggcgaccttcacggtcacccgtgaagccgcaggct
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 341 ccgcgatcgccgccgggctgggggcggcgaccttcacggtcacccgtgaagccgcaggct
Query: 301 ccatcacgcaggaagcggtggagtacgcacttgcccggcggaccgccgtcgtgatcgccg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 401 ccatcacgcaggaagcggtggagtacgcacttgcccggcggaccgccgtcgtgatcgccg
Query: 361 ttccatacgacctgtcggcccttgaggcggcggaggaagatcttcccgtgccgccggcgg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 ttccatacgacctgtcggcccttgaggcggcggaggaagatcttcccgtgccgccggcgg
Query: 421 cctcggttccggacgccatcggcggcggactcggacgggcggccgaagtgcgggcggccg
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 521 cctcggttccggacgccatcggcggcggactcggacgggcggccgaagtgcgggcggccg
Query: 481 aattgctggcgggcgcgaagcggccgctcatccttgccggccgcggtgcgcacctcgcag
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 581 aattgctggcgggcgcgaagcggccgctcatccttgccggccgcggtgcgcacctcgcag
|
Organism Name
Sequence Length
Patent sequence
– each
USGENE record is based
upon a sequence
Feature table
- includes
sequence modifications and
other features, as provided by
the patent applicant
A typical
BLAST alignment following a BLASTN (/SQN) search in
USGENE.
|
|
STN Easy
